Using Unweighted Pair-group Method With Arithmetic Average Research Articles

Molecular genetic diversity analysis in short duration pigeonpea [Cajanus cajan (L.) Millsp.]

In the present study, 48 short duration pigeonpea genotypes were used to analyse molecular diversity employing 20 pigeonpea specific microsatellite markers. Among the 20 microsatellite markers, 11 markers produced polymorphism and nine markers showed monomorphic banding patterns. A total of 35 alleles were generated and the number of alleles produced by different markers ranged from one to three with an average of 1.75 alleles per marker. The polymorphic markers viz., PGM 82, CcM 1615, CcM 2857 and CcM 1277 produced a maximum of three alleles. The allele size ranged from 150 bp (CcLG08_RFQI4) to 290 bp (CcM 1277). The average PIC value obtained was 0.269. The data analysis for microsatellite markers showed high dissimilarity among 48 genotypes. A dendrogram was constructed using Unweighted Pair Group Method with Arithmetic Average (UPGMA) analysis, 48 genotypes were grouped into seven clusters with the similarity coefficient ranged from 0.43 to 1.00. Among the seven clusters, subcluster 1 of cluster I was the largest with fifteen genotypes followed by nine genotypes in the subcluster 2 of cluster II. From this study, it is concluded that the diverse pigeonpea genotypes viz., ICPL 19009, ICPL 19019, ICPL 19030 (cluster I), ICPL 19002 (cluster VI) and CO 6R (cluster VII) could be utilized in the breeding program based on microsatellite marker and cluster analysis. Keywords: Pigeonpea, microsatellite markers, molecular genetic diversity, Polymorphic Information Content, UPGMA clustering.

Morphological Diversity of Local Sorghum Cultivar (Sorghum bicolor) of East Nusa Tenggara, Indonesia

Sorghum has great potential to be developed in marginal lands of Indonesia including East Nusa Tenggara. However, the information about sorghum diversity in this area was very limited. This research aimed to describe morphological variation, and assessing the value of genetic diversity based on morphological characters of local sorghum cultivar of East Nusa Tenggara. The exploration and sample collection were conducted in 3 islands, i.e.: Timor, Sumba, and Flores. The observation of morphological characters was based on sorghum descriptor. Morphological character similarities were analyzed using Simple Matching (SM) coefficient, and a dendrogram was constructed using Unweighted Pair Group Method with Arithmetic Average (UPGMA) method. The results showed that 36 accessions of sorghum in East Nusa Tenggara varied in 17 morphological characters. At the similarity coefficients of 48%, all sorghum accessions were separated into 2 groups based on the presence or absence of aleurone layer. Group I consisted of 12 accessions with no aleurone layer, while group II consisted of 24 accessions has aleurone layer. The genetic diversity of sorghum of East Nusa Tenggara is low (I=0.62–0.71 and h=0.37-0.42). The genetic diversity between populations (HT=0.4203) is higher than within populations (HS=0.3961). This study provides the first complete information about sorghum diversity in East Nusa Tenggara that will be useful as basic information for sorghum development in this area in the future.

Genetic Diversity Analysis of Medicinally Important Horticultural Crop Aegle marmelos by ISSR Markers.

Inter simple sequence repeat (ISSR) markers help in identifying and determining the extent of genetic diversity in cultivars. Here, we describe their application in determining the genetic diversity of bael (Aegle marmelos Corr.). Universal ISSR primers are selected and their marker characteristics such as polymorphism information content, effective multiplex ratio and marker index have been evaluated. ISSR-PCR is then performed using universal ISSR primers to generate polymorphic bands. This information is used to determine the degree of genetic similarity among the bael varieties/accessions by cluster analysis using unweighted pair-group method with arithmetic averages (UPGMA). This technology is valuable for biodiversity conservation and for making an efficient choice of parents in breeding programs.

Phenotypic and genotypic diversity of Xanthomonas axonopodis pv. manihotis causing bacterial blight disease of cassava in Kenya

Cassava bacterial blight (CBB), caused by Xanthomonas axonopodis pv. manihotis (Xam), is the most important bacterial disease of cassava. There is no information available on the morphological and genetic variability of Xam isolates from Kenya. The aim of this study therefore, was to determine the diversity of Xam isolates from different cassava growing regions of Kenya using phenotypic characteristics and repetitive DNA polymerase chain reaction-based fingerprinting (rep-PCR). Thirty three isolates were recovered from infected cassava leaf samples collected from farmers’ fields in cassava growing regions. The dendrogram generated from analysis of phenotypic characteristics of the isolates produced two major clusters at 75% similarity level. Analysis of 19 isolates with repetitive extragenic palindromic (rep) primers yielded characteristic fingerprint pattern with bands ranging between 400 and 2000 bp in size and their numbers ranged from 1 to 6 bands per isolate. Cluster analysis using unweighted pair group method with arithmetic averages (UPGMA) did not reveal any significant differences in clustering and relationship to the geographical origin, with exception of a single isolate that had unique fingerprints. These findings indicate that Xam population in Kenya evolved from the same origin and is a uniform population, and this may prove useful in future breeding programmes.

Analysis of population structure of Blysmus sinocompressus in the Qilian Mountains by ISSR markers

Blysmus sinocompressus (Cyperaceae) is an edificator and dominant wetland endemic grass of ecological and economical importance to northwestern China. Inter-simple sequence repeats (ISSR) were used to reveal the genetic diversity and population genetic structure in nine populations of B. sinocompressus in the Qilian Mountains. The genetic diversity of B. sinocompressus was high at species levels (PPBs=74.76%, Hs=0.1668), but relatively low at population levels (PPBp=31.01%, Hp=0.0941). A significant genetic differentiation (Gst=0.4355) and low gene flow (Nm=0.6480) were found among populations. Analysis of molecular variance (AMOVA) test revealed that 55.52% genetic variation occurred within populations and the remaining 44.48% was found among populations. Using unweighted pair-group method with arithmetic average (UPGMA) dendrogram, the nine populations were classified into three groups: (1) a single population of ZMS from Heihe River; (2) the YHLK population (Heihe River) and a subcluster of populations from Qinghai Lake; (3) the QLHH population (Heihe River) and a subcluster of populations from Daitong River. Similar results were obtained by using Principal coordinates analysis (PCoA) and Bayesian cluster analysis. Moreover, the genetic diversity of B. sinocompressus was negatively correlated with latitude, while positively correlated with annual mean temperature. With these observations, we propose a much needed conservation strategy for this plant in the Qilian Mountains.

English

Genetic diversity within Gerbera jamesonii Bolus is the key to genetic improvement of this important ornamental species. In the present study, genetic diversity of 12 accessions of gerbera was assessed through random amplified polymorphic DNA (RAPD) markers. A total of 40 RAPD primers belonging to OPD, OPE, OPF and OPG series of universal primers set were used out of which, only 10 primers produced clear, reproducible and scorable bands. Ten (10) decamer RAPD primers produced a total of 49 scorable bands from 12 genotypes of G. jamesonii Bolus, out of which 42 were polymorphic and seven were monomorphic. The percentage of polymorphism ranged from a maximum of 100.00% by OPE-02, OPE-14, OPF-18, OPG-18, OPG-16 and OPG-17 to a minimum of 50.00% by OPE-08. The RAPD profiles generated were further evaluated for studying the Jaccard’s similarity coefficient. The average genetic similarity coefficient for the 12 accessions evaluated by Jaccard index was 0.66 ranging from 0.35 to 0.86. The RAPD amplification data were used to obtain similarity matrix and for generation of dendrogram using unweighted pair group method with arithmetic averages (UPGMA) method. Based on the dendrogram, all 12 genotypes could be distinctly divided into two clusters and the accession CF Orange was found most dissimilar from other accessions. This study shows that DNA based molecular marker RAPD is a powerful, less time consuming and cost effective molecular technique for assessment of genetic diversity among different genotypes of G. jamesonii Bolus. The availability of these gerbera RAPD markers would facilitate the use of molecular markers in gerbera breeding and genetic studies.   Key words: Gerbera jamesonii Bolus, molecular markers, genetic diversity, RAPD.

Genetic diversity and relationships among different tomato varieties revealed by EST-SSR markers

The genetic diversity and relationship of 42 tomato varieties sourced from different geographic regions was examined with EST-SSR markers. The genetic diversity was between 0.18 and 0.77, with a mean of 0.49; the polymorphic information content ranged from 0.17 to 0.74, with a mean of 0.45. This indicates a fairly high degree of diversity among these tomato varieties. Based on the cluster analysis using unweighted pair-group method with arithmetic average (UPGMA), all the tomato varieties fell into 5 groups, with no obvious geographical distribution characteristics despite their diverse sources. The principal component analysis (PCA) supported the clustering result; however, relationships among varieties were more complex in the PCA scatterplot than in the UPGMA dendrogram. This information about the genetic relationships between these tomato lines helps distinguish these 42 varieties and will be useful for tomato variety breeding and selection. We confirm that the EST-SSR marker system is useful for studying genetic diversity among tomato varieties. The high degree of polymorphism and the large number of bands obtained per assay shows that SSR is the most informative marker system for tomato genotyping for purposes of rights/protection and for the tomato industry in general. It is recommended that these varieties be subjected to identification using an SSR-based manual cultivar identification diagram strategy or other easy-to-use and referable methods so as to provide a complete set of information concerning genetic relationships and a readily usable means of identifying these varieties.

Occurrence of Biosurfactant Producing Bacillus spp. in Diverse Habitats.

Diversity among biosurfactant producing Bacillus spp. from diverse habitats was studied among 77 isolates. Cluster analysis based on phenotypic characteristics using unweighted pair-group method with arithmetic averages (UPGMAs) method was performed. Bacillus isolates possessing high surface tension activity and five reference strains were subjected to amplified 16S rDNA restriction analysis (ARDRA). A correlation between the phenotypic and genotypic characterization of Bacillus spp. is explored. Most of the oil reservoir isolates showing high surface activity clustered with B. licheniformis and B. subtilis, the hot water spring isolates clustered in two ingroups, while the petroleum contaminated soil isolates were randomly distributed in all the three ingroups. Present work revealed that diversity exists in distribution of Bacillus spp. from thermal and hydrocarbon containing habitats where majority of organisms belonged to B. licheniformis and B. subtilis group. Isolate B. licheniformis TT42 produced biosurfactant which reduced the surface tension of water from 72 mNm−1 to 28 mNm−1, and 0.05 mNm−1 interfacial tension against crude oil at 80°C. This isolate clustered with B. subtilis and B. licheniformis group on the basis of ARDRA. These findings increase the possibility of exploiting the Bacillus spp. from different habitats and their possible use in oil recovery.

Random amplified polymorphic DNA analysis of Thunbergia laurifolia Lindl. and its related species

Thunbergia laurifolia Lindl. is an important herb in Thai folk medicine that has been widely used as an antidote, anti-inflammatory and antipyretic. However, counterfeits of T. laurifoliahave been commonly found in Thai herbal markets and have arisen based on their similarity in appearance and shared common names. Flowers of plants belonging to Thunbergiaspp., including T. laurifolia, Thunbergia grandiflora and Thunbergia erecta, look similar to each other, which often cause confusion when identifying these species. Moreover, there is another group of plants with names that share a similar common Thai name, “Rang Chuet”, which includes a Curcuma sp., Rinorea sp., Crotalaria spectabilis, and T. laurifolia. In this study, we developed a random amplified polymorphic DNA (RAPD) method to facilitate the rapid detection of these medicinal materials. Out of 80 screened primers, nine gave clear and reproducible RAPD patterns. Among 164 amplified bands, 70 bands were polymorphic in six species. The dendrogram was constructed using unweighted pair group method with arithmetic averages (UPGMA), and the genotypes were differentiated into three main groups. The RAPD profiles of six species showed low similarity indices (0.1235 to 0.3137), whereas the genetic relationship was associated with the botanical characterization. These results indicate that RAPD is a useful tool for differentiating T. laurifolia from its related species.   Key words: Acanthaceae, DNA fingerprint, molecular characterization, random amplified polymorphic DNA, Thunbergia laurifolia.

Genetic Differentiation of Pseudomonas syringae Pathovar tomato from Other P. syringae Pathovars using REP-PCR and URP-PCR

For the genetic differentiation of <TEX>$Pseudomonas$</TEX> <TEX>$syringae$</TEX> pathovar <TEX>$tomato$</TEX>, a total of 51 <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. strains infecting 33 different host plants were analyzed using repetitive element PCR(REP-PCR) and universal rice primer PCR(URP-PCR). The entire DNA fingerprint profiles were analyzed using unweighted pair-group method with arithmetic averages (UPGMA). The 51 <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. strains could be divided into five clusters based on 65% similarity by Rep-PCR using BOX, ERIC, and REP primers. <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> cluster was well separated from other 31 <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pathovars. <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> cluster included only <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$maculicola$</TEX> and <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX>. <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> strains could be divided into two genetic groups. Meanwhile, the Pseudomonas pv. strains could be divided into four clusters based on 63% similarity by URP-PCR using 2F, 9F, and 17R primers. <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> cluster was also well separated from 30 other <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pathovars. In this case, <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> cluster included <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$maculicola$</TEX>, <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$berberidi$</TEX>, and <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX>. <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> strains was also separated into two genetic groups by URP-PCR analysis. Overall, our work revealed that <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> can be genetically differentiated from other <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pathovars by the DNA fingerprint profiles of REP-PCR and URP-PCR. We first report that there are two genetically diverged groups in <TEX>$P.$</TEX> <TEX>$syringae$</TEX> pv. <TEX>$tomato$</TEX> strains.

Genetic diversity of two Tunisian sheep breeds using random amplified polymorphic DNA (RAPD) analysis

Random amplified polymorphic DNA (RAPD) markers were used to study genetic diversity and population structure in six sheep populations belonging to two native Tunisian breeds (the Barbarine and the Western thin tail). A total of 96 samples were typed using eight RAPD primers. 62 bands were scored, of which 44 bands (70.97%) were polymorphic. For all populations, Nei’s gene diversity, Shannon index and percentage of polymorphic loci are respectively in the range of 0.17-0.25, 0.25 to 0.35, 43.55 to 53.23. Between breeds, higher heterozygosity value (0.24) was found within the Western thin tail breed. Using unweighted pair-group method with arithmetic average (UPGMA) dendrogram, the six populations clustered into two groups, each one contained populations of the same breed. Analysis of molecular variance (AMOVA) showed that the variation between breeds is 30.80%, and that the variation between populations of Barbarine breed and populations of Western thin tail breed are 6.06 and 11.83%, respectively. Key words: Genetic diversity, RAPD, Tunisian sheep, Bioclimatic zones.

Genetic diversity among commercial coffee varieties, advanced selections and museum collections in Kenya using molecular markers

Molecular markers have effectively been applied to study genetic diversity and as markers of particular traits. This study assessed the diversity of twenty four (24) coffee genotypes using 10 Random Amplified Polymorphic DNA (RAPD) primers and 2 microsatellites (M24 and Sat 235). A total of 35 polymorphic bands were generated by the RAPD primers. The bands were scored for presence (1) and absence (0) of amplified products. The data was subjected to cluster analysis using R statistical software and a dendrogram constructed using Unweighted Pair Group Method with Arithmetic Average (UPGMA). The genotypes separated into three main clusters. C. eugenioides clustered alone in the first cluster while un-introgressed Arabica genotypes dominated the second cluster. The third cluster comprised of Coffea canephora (Robusta) and introgressed genotypes, Ruiru 11, Hibrido de Timor and Catimor. Robusta and C. eugenioides were the most distantly related and generated most of the diversity observed. The similarities observed among un-introgressed Arabica genotypes attest to the narrow genetic diversity within Coffea arabica. The divergence observed among introgressed genotypes could be utilized in future breeding programmes.   Key words: Coffee accessions, RAPD, microsatellites, diversity, Kenya.

Evaluation of SSR Markers for the Assessment of Genetic Diversity and Fingerprinting of Gossypium hirsutum Accessions

A total 177 simple sequence repeat (SSR) markers were screened using a set of 47 Upland cotton genotypes comprising 14 commercial varieties, 14 germplasm accessions and 19 advanced breeding lines to identify informative markers for genetic diversity assessment and fingerprinting in G. hirsutum. Only 21% (381177) of SSR markers tested showed polymorphism with a mean of 2.18 alleles per locus and with average polymorphism information content (PIC) of 0.32. The SSR markers revealed a Jaccard’ similarity coefficient ranging between 0.43 and 0.89, with an average of 0.67 among accessions. Cluster analysis using unweighted pair group method with arithmetic averages (UPGMA) and principal component analysis (PCA) indicated that majority of the genotypes were very closely related. All the 47 genotypes showed heterorygosity for at least one of the SSR loci. We discovered 19 rare and 6 unique alleles among the tested genotypes of cotton. Fingerprint based on all the 38 loci revealed a probability of identical match by chance of 3.98x10. A set of ten SSR markers was identified which could distinguish all the 47 genotypes with a moderate probability of identical match by chance (XDn = 0.01).

Assessment of Genetic Diversity and Relationship of Tea Germplasm in Yunnan as Revealed by ISSR Markers

The relationship and the genetic diversity of 134 accessions of the Yunnan tea [ Damellia sinensis (L.) O. Kuntze] germplasm belonging to 8 species were analyzed to provide guidance for breeding of tea tree. Using 18 inter-simple sequence repeats (ISSR) primers, a total of 475 fragments were amplified, of which 470 bands were polymorphic. The genetic similarity (GS) among the accessions tested ranged from 0.445 to 0.819 with an average of 0.512. These results indicated a rich diversity in the tested genetic germplasm of tea. Based on the cluster analysis using unweighted pair-group method with arithmetic average (UPGMA), all the tea accessions fell into 3 groups with no obviously geographical character. The principal component analysis (PCA) supported the clustering result, but relationships among accessions were more explicit in the PCA graph than the UPGMA dendrogram. The genetic variation among species was small, as the average GS among species was 0.92, ranging from 0.850 to 0.987.

URP-based DNA Fingerprinting ofBipolaris sorokinianaIsolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP-PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS-49 was least virulent showing 4.5 infection index while BS-75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS-53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP-2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP-PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.

Molecular Characterization of Fusarium Oxysporum F. Sp. Cubense of Banana

Problem statement: Morphological characterization of Fusarium species which emphasize on microscopic and cultural characteristics are not sufficient to characterize Fusarium Oxysporum F. sp. Cubense (FOC) from banana as these characteristics could easily influence by environmental factors. As an alternative molecular methods were used to characterize and to assess genetic variation of FOC from different banana cultivars. Knowledge on the genetic variation is important to determine the genetic relationship between FOC isolates from different banana cultivars. Approach: Two PCR-based methods, Enterobacterial Repetitive Intergenic Consensus-PCR (ERIC-PCR) and restriction analysis of the Internal Transcribed Spacer and 5.8S regions (ITS+5.8S regions) were used to characterize Fusarium Oxysporum F. sp. Cubense (FOC) isolates from different banana cultivars. The genetic relationship of the FOC isolates were analyzed using Un-weighted Pair-Group Method with Arithmetic Averages (UPGMA) cluster analysis based on Jaccard Similarity Coefficient. Results: Restriction patterns of the ITS+5.8S regions using nine restriction enzymes namely, Alu I, Eco RI, Eco 88I, Bsu RI, Bsu 15I, Hin fI, Hin 6I, Msp I and Taq I and ERIC-PCR showed low variation among the FOC isolates studied, indicating close relationship among the isolates. Un-weighted Pair-group Method with Arithmetic Averages (UPGMA) cluster analysis based on Jaccard Similarity Coefficient showed that the FOC isolates were grouped into two main clusters with similarity value of 41.4-100% in PCR-RFLP of ITS + 5.8S and 45-100% similarity based on ERIC-PCR analysis, respectively. Cluster analysis of the combined data also showed that the FOC isolates were grouped into two clusters, sharing 42.9-100% similarity. Conclusion/Recommendations: The results of the present study indicate that the FOC isolates were closely related regardless of banana cultivars and location.

Genetic diversity of African maize inbred lines revealed by SSR markers

Knowledge of genetic diversity (GD) and relationships among maize inbred lines is indispensable in a breeding program. Our objectives were to (1) investigate the level of genetic diversity among maize inbred lines and (2) assess their genetic structures by applying simple sequence repeat (SSR) markers. Fifty-six highland and mid-altitude maize inbred lines obtained from CIMMYT programs in Ethiopia and Zimbabwe were genotyped using 27 SSR loci. All of the genotypes studied could unequivocally be distinguished with the combination of the SSRs used. In total, 104 SSR alleles were identified, with a mean of 3.85 alleles per locus. The average polymorphism information content (PIC) was 0.58. GD expressed as Euclidean distance, varied from 0.28 to 0.73 with an average of 0.59. Cluster analysis using unweighted pair group method with arithmetic average (UPGMA) suggested five groups among the inbred lines. Most of the inbred lines adapted to the highlands and the mid-altitudes were positioned in different clusters with a few discrepancies. The pattern of groupings of the inbred lines was mostly consistent with available pedigree information. The variability detected using SSR markers could potentially contribute towards effective utilization of the inbred lines for the exploitation of heterosis and formation of genetically diverse source populations in Ethiopian maize improvement programs.

Genetic differentiation of charcoal rot pathogen,Macrophomina phaseolina, into specific groups using URP-PCR

Forty isolates of Macrophomina phaseolina, a pathogen causing charcoal dry root rot of soybean, cotton, and chickpea, were genetically characterized with universal rice primers (URP; primers derived from DNA repeat sequences in the rice genome) using polymerase chain reaction (URP-PCR). Out of 12 URPs used in this study, 5 primers were effective in producing polymorphic fingerprint patterns from the DNA of M. phaseolina isolates. Three primers (URP-2F, URP-6R, and URP-30F) were quite informative and produced high levels of polymorphism among the isolates of M. phaseolina. Analysis of the entire fingerprint profiles using unweighted pair-group method with arithmetic averages (UPGMA) clearly differentiated M. phaseolina isolates obtained from soybean, cotton, and chickpea hosts into specific groups. In this study, we found for the first time transferability and use of PCR primers derived from plant genomes to generate host-specific fingerprint profiles of M. phaseolina, a broad host range plant pathogenic fungus. These results demonstrate that URPs are sensitive and technically simple to use for assaying genetic variability in M. phaseolina populations.

GENETIC VARIABILITY IN MANGO GENOTYPES DETECTED BY RAPD MARKERS

Forty mango genotypes of the Embrapa Meio-Norte mango collection were examined for RAPD markers with 32 random primers. Thirteen of these 32 initially screened primers that indicated more polymorphic DNA amplification patterns were selected for the RAPD reactions. Each genotype was characterized by its banding pattern, using DNA Ladder 1 kb as standard DNA. A genetic similarity matrix based on Jaccard's coefficient, and a phenogram using unweighted pair-group method with arithmetic average (UPGMA) clustering was constructed. Initially the genotypes were grouped into two distinct groups (J=0.36): one formed by 'Mallika' and 'Amrapali' and another comprised of the other genotypes, which was subdivided into other two groups (J=0.41), one formed by 'Manzanilo', 'Van Dyke' 'Palmer' and 'Keitt', and the other including the remaining genotypes. This latter group was still splited in two other groups (J=0.54), one including 'Edward', 'Winter', 'Alfa Emprapa 142', 'Kensington' and the advanced breeding selection CPAC 98/86 ('Beta') and the other, including 'Santa Alexandrina', 'Sensation', 'Glenn', 'Irwin' and all 25 Rosa's genotypes. In Rosa's group, the similarity coefficient ranged from 0.55 to 0.98, indicating a reasonable amount of genetic variation within this cultivar. Bootstrap consistency test, however, indicated that only three groups ('Mallika' and 'Amrapali', 'Van Dyke', 'Palmer' and 'Keitt', and 'Irwin' and 'Glenn') were really diverged.

Subtyping of foodborne and environmental isolates of Escherichia coli by multiplex-PCR, rep-PCR, PFGE, ribotyping and AFLP

A total of 54 isolates were characterized by multiplex-PCR for toxin genes and genotyped using several DNA fingerprinting methods: using repetitive extragenic palindromes (REP) and Box primers (rep-PCR), amplified fragment length polymorphism (AFLP), pulsed-field gel electrophoresis (PFGE) and ribotyping. The known-pathogenic strains tested were from food and clinical samples (34 strains) and included serovars O157:H7, O111:H8, O111:H11, O91:H21 and O55:H7. Two type cultures, Escherichia coli K12 (ATCC 29425) and DUP-101 (ATCC 51739), were included as known non-pathogenic strains and an additional 17 previously unclassified isolates from animal fecal samples. Comparisons of genomic DNA fingerprint patterns using unweighted pair group method with arithmetic averages (UPGMA) cluster analysis of Jaccard similarity indices indicated that all methods tested showed a greater similarity between the E. coli O157:H7 strains than to other isolates. On the basis of these studies, we propose that AFLP, REP-PCR, Box-PCR and ribotyping techniques can all be used for discriminating O157:H7 isolates and are preferred for large-scale screening because of the speed and ease of the methods. The PFGE method is the best to discriminate between subtypes of O157:H7 associated with specific outbreak investigations; however, it is more time consuming and unnecessary if subtyping is not required. There are differences between the dendrograms generated from each method and the relationship between the other strains analyzed. However, the fingerprint profiles of the O157:H7 isolates were virtually identical using REP-PCR and Box-PCR enabling easy distinction of the group. Thus, these typing methods have the potential to aid investigators in identifying the source of an outbreak to prevent or control further spread of E. coli O157:H7.